Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

EMM65
(Plasmid #49042)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49042 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    unknown
  • Backbone manufacturer
    Joung Lab
  • Backbone size (bp) 8550
  • Modifications to backbone
    Replaced p65 with LSD1
  • Vector type
    Mammalian Expression ; TALE LSD1 Expression Vector
  • Promoter EF1 alpha
  • Tag / Fusion Protein
    • LSD1 (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATGACGCAGTTCGGGATGAG
  • 3′ sequencing primer TTCGGGAATACGGCGATTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EMM65 was a gift from Bradley Bernstein & Eric Mendenhall (Addgene plasmid # 49042 ; http://n2t.net/addgene:49042 ; RRID:Addgene_49042)
  • For your References section:

    Locus-specific editing of histone modifications at endogenous enhancers. Mendenhall EM, Williamson KE, Reyon D, Zou JY, Ram O, Joung JK, Bernstein BE. Nat Biotechnol. 2013 Sep 8. doi: 10.1038/nbt.2701. 10.1038/nbt.2701 PubMed 24013198