-
PurposeOne half component of the optimized Cre recombinase dependent on GFP (CRE-DOG OPT) for rAAV production and expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69570 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
AAV1 | 69570-AAV1 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | $405 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-EF1a-GTB
- Backbone size w/o insert (bp) 5329
- Total vector size (bp) 6085
-
Vector typeMammalian Expression, AAV, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namekozak consensus - N-CretrcintG
-
SpeciesSynthetic
-
Insert Size (bp)741
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer acactgagtgggtggagactg
- 3′ sequencing primer CAAACACAGTGCACACCACG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGBP7 obtained from Heinrich Leonardt and Ulrich Rothbauer at Ludwig Maximilians University Munich
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Information for AAV1 (Catalog # 69570-AAV1) ( Back to top )
Purpose
Ready-to-use AAV1 particles produced from pAAV-EF1a-N-CretrcintG (#69570). In addition to the viral particles, you will also receive purified pAAV-EF1a-N-CretrcintG plasmid DNA.
EF1a-driven expression of optimized N-terminal component of Cre recombinase dependent on GFP (Cre-DOG OPT); to be coinjected with pAAV-EF1a-C-CreintG (Addgene catalog# 69571) and GFP (or for use with transgenic GFP animals). These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
- Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
- Serotype AAV1
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-N-CretrcintG was a gift from Connie Cepko (Addgene plasmid # 69570 ; http://n2t.net/addgene:69570 ; RRID:Addgene_69570)
For viral preps, please replace (Addgene plasmid # 69570) in the above sentence with: (Addgene viral prep # 69570-AAV1)
-
For your References section:
Cell type-specific manipulation with GFP-dependent Cre recombinase. Tang JC, Rudolph S, Dhande OS, Abraira VE, Choi S, Lapan SW, Drew IR, Drokhlyansky E, Huberman AD, Regehr WG, Cepko CL. Nat Neurosci. 2015 Sep;18(9):1334-41. doi: 10.1038/nn.4081. Epub 2015 Aug 10. 10.1038/nn.4081 PubMed 26258682