Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV-EF1a-Flp-DOG-NW
(Plasmid #75469)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 75469 Standard format: Plasmid sent in bacteria as agar stab 1 $85
AAV1 75469-AAV1 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $405

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-EF1a-GTB
  • Backbone size w/o insert (bp) 5329
  • Total vector size (bp) 6704
  • Vector type
    Mammalian Expression, AAV, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Flp-DOG
  • Alt name
    dGBP1x2-Flpo
  • Species
    Synthetic
  • Insert Size (bp)
    1986
  • Promoter EF-1a

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AGTGGGTGGAGACTGAAGTTAGG
  • 3′ sequencing primer CACTGCACTCCAGCTTGGTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Information for AAV1 (Catalog # 75469-AAV1) ( Back to top )

Purpose

Ready-to-use AAV1 particles produced from pAAV-EF1a-Flp-DOG-NW (#75469). In addition to the viral particles, you will also receive purified pAAV-EF1a-Flp-DOG-NW plasmid DNA.

EF1a-driven expression of Flp recombinase dependent on GFP (Flp-DOG); to be coinjected with GFP (or for use with transgenic GFP animals). These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-Flp-DOG-NW was a gift from Connie Cepko (Addgene plasmid # 75469 ; http://n2t.net/addgene:75469 ; RRID:Addgene_75469)

    For viral preps, please replace (Addgene plasmid # 75469) in the above sentence with: (Addgene viral prep # 75469-AAV1)

  • For your References section:

    Detection and manipulation of live antigen-expressing cells using conditionally stable nanobodies. Tang JC, Drokhlyansky E, Etemad B, Rudolph S, Guo B, Wang S, Ellis EG, Li JZ, Cepko CL. Elife. 2016 May 20;5. pii: e15312. doi: 10.7554/eLife.15312. 10.7554/eLife.15312 PubMed 27205882