Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Vector Database


Welcome to Vector Database!

Vector database is a digital-only collection of vector backbone information compiled by Addgene from third party sources.

This vector is NOT available from Addgene and the database is no longer actively maintained.

This vector is not available from Addgene.

Plasmid: pGMR

Information

Alt Name
GMR
Plasmid Type
eye expression vector
Expression Level
Unknown
Cloning Method
Restriction Enzyme
5' Sequencing 1 Primer
GMR P1
5' Sequencing 1 Primer Sequence
CGTCGCTAAGCGAAAGCTAAGCAA
5' Terminal
N-Term
Notes
Reference: Development 120, 2121-2129 (1994) https://www.ncbi.nlm.nih.gov/pubmed/7925015 PCR was used to amplify a fragment from construct 29-1 (Ellis et al.,1993). This fragment contains a pentamer of truncated glass-binding sites derived from the Drosophila Rh1 promoter. The primers used to amplify this pentamer and downstream TATA box sequences were ATCGATATCTAGATCTCGAG and GAACTCTGAATAGGGAATTCGGG. These primers contain XhoI and EcoRI sites, respectively, near their 3′ end. PCR products (about 500 bp) were digested with XhoI and EcoRI and ligated into XhoI, EcoRI cut CaSpeR-hs (Pirotta, 1988), thus replacing the HSP 70 promoter and TATA box of CaSpeR-hs with the PCR product derived from construct 29-1. The vector generated is known as pGMR (glass multimer reporter). The expression vector pGMR contains the white marker gene (white), a multimer of glass binding sites (GBS), TATA sequences from the hsp70 promoter (TATA), approximately 200 bases of 5′ untranslated region, a polylinker, and the hsp 70 3′ untranslated region. FlyBase partial sequence for pGMR: http://flybase.org/reports/FBrf0093307.html
Stable
Unspecified
Constitutive
Unspecified
Viral/Non-Viral
Nonviral