ddPCR Titration of Lentivirus Vectors
Introduction
This protocol describes how to use droplet digital PCR (ddPCR) to titer lentivirus vectors. This protocol specifically uses primers and probes targeting integrated copies of the Rev response element (RRE) in the target cells but can be modified for other targets. Primers and a probe against the cellular ribonuclease P/MRP 30 kDa subunit (RPP30) are used as a control for normalization. The dilution series outlined in this protocol is based on an LV titer range of 1E+05–1E+09 TU/mL, where TU is transducing units and generally represents the number of infective viral particles. Users may need to run lower or higher dilutions depending on their particular sample.
This protocol was modified from the publication Wang et al., 2018 Hum Gene Ther Methods. .
Before Starting
- Thaw the master mix, primers/probe mixes and samples on ice before use.
- Wipe down all pipettes and surfaces with 10% bleach.
Safety Warnings
Lentivirus is generally considered biosafety level 2+. Please ensure that you are in compliance with your institution’s biosafety regulations.
Last Update: June 12, 2023
Workflow Timeline
- Day 1: Seed and transduce cells
- Day 4: Treat cells with Benzonase and harvest cells
- Day 4+: ddPCR and analysis
Equipment
- class II, Type A2 Biological Safety Cabinet, Labconco 302411100
- aspirating Unit
- microcentrifuge, Eppendorf, 5425R
- droplet digital PCR System, Bio-Rad, DX200
- thermal Cycler, Bio-Rad, T100
- PCR Plate Sealer, Bio-Rad, PX1
- 1-10 µL single channel pipette
- 20-200 µL single channel pipette
- 200-1000 µL single channel pipette
- 2-50 µL multichannel pipette
- 20-200 µL multichannel pipette
- ice bucket
- 96-well freezer blocks
- vortex, VWR, 10153-688
- mini Centrifuge, Thermo Scientific, 10199-452
Reagents
- GeneJet Genomic DNA Purification Kit, Thermo Fisher, K0721
- 6-well tissue culture treated dish, VWR, 29442-042
- DMEM, high glucose, pyruvate, Corning, 10-013-CV
- heat inactivated premium grade, fetal bovine serum, Seradigm, 1500-050H
- Glutagro, 200 mM, Corning, 25-015-CI
- 1X Phosphate Buffered Saline, Corning, 21-040-CV
- TrypLE, Thermo Fisher, 12605010
- ethanol, VWR, EX0276-1
- benzonase 250 U/µl, Millipore #71205-3
- polybrene 10 mg/mL, Millipore, TR-1003-G
- molecular Biology Grade Water, Hyclone, SH30538.02
- ddPCR Supermix for Probes no dUTP, Bio-Rad,1863023
- droplet generation oil, Bio-Rad, 1863005
- DG8 cartridge, Bio-Rad, 1864008
- DG8 gasket, Bio-Rad, 1863009
- DG8 cartridge holder, Bio-Rad, 1863051
- 8-strip PCR tubes, Axygen, PCR-02-FCP-C
- ddPCR 96-well PCR plates, Bio-Rad, 12001925
- pierceable Foil Heat Seal, Bio-Rad, 1814040
- polystyrene Reservoirs, VWR, 89094-662
- microcentrifuge tubes, VWR, 87003-294
- primers/probe targeting RRE:
- forward primer: tgtgccttggaatgctagt
- probe (FAM): tttggaatcacacgacct
- reverse primer: aatttctctgtcccactccatc
- PrimePCR ddPCR Copy Number Assay: RPP30, Human, Bio-Rad, 10031244
Reagent Preparation
- DMEM Complete:
- 500 mL DMEM, high glucose, pyruvate
- 55 mL heat inactivated premium grade, fetal bovine serum
- 5 mL Glutagro
- 50 U/mL benzonase:
- 15 mL DMEM Complete
- 3 µL of 250 U/µL benzonase
Procedure
Transducing Cells
- Thaw the virus on ice.
- Prepare the following dilution series of virus in DMEM complete:
- When adding the virus to the diluent, pipette 5 times, to remove virus from pipette tip.
- To mix each dilution, set the P200 pipette to 200 µL and pipette 10-20 times.
- Use a new pipette tip to transfer the virus to the next dilution.
- Repeat for all dilutions.
- Add 150 µL of each viral dilution to a well of a 6-well plate (1 dilution per well). Leave one well untransduced.
- Seed 300,000 cells/well in 1350 µL media and 11.1 µg/mL Polybrene into the wells containing the virus and the untransduced control.
- When seeding, 150 µL of virus is being diluted an additional 10-fold in media therefore the final dilutions range from 25-1600-fold.
- Mix each well with a 1-mL pipette 5-10 times.
- The final volume in the well is 1.5 mL and the final Polybrene concentration is 10 µg/mL.
- Mix well and incubate 72 hours.
Dilution Factor | Virus Volume to Dilute | Media Volume | Total Volume |
---|---|---|---|
2.5 | 160 µL viral stock | 240 µL | 400 µL |
5 | 200 µL of 2.5-fold dilution | 200 µL | 400 µL |
10 | 200 µL of 5-fold dilution | 200 µL | 400 µL |
20 | 200 µL of 10-fold dilution | 200 µL | 400 µL |
40 | 200 µL of 40-fold dilution | 200 µL | 400 µL |
80 | 200 µL of 80-fold dilution | 200 µL | 400 µL |
160 | 200 µL of 160-fold dilution | 200 µL | 400 µL |
*Pro-Tip*For even seeding, prepare a batch for 10 wells with 3,000,000 cells in 13.5 mL of media and 11.1 µg/mL Polybrene. Mix the cell suspension well before seeding.
Benzonase Digestion and Cell Harvest
- Gently aspirate media from the 6-well plates.
- Add 1.5 mL of 50 U/mL Benzonase in DMEM complete to each well.
- Incubate at 37 °C for 30 minutes.
- Gently aspirate media from wells.
- Wash wells with 1 mL of 1X PBS and aspirate.
- Detach cells by incubating with 200 µL TrypLE for 1-2 minutes.
- Resuspend cells in 500 µL DMEM complete and transfer to a microcentrifuge tube.
- Centrifuge for 5 minutes at 100 x g.
- Gently aspirate supernatant.
- Wash cell pellets in 500 µL PBS.
- Centrifuge for 5 minutes at 100 x g.
- Gently aspirate supernatant.
- Extract genomic DNA according to the GeneJet Genomic DNA Purification Kit instructions.
- Determine the concentration of each sample on a spectrophotometer.
- Prepare 25ng/ µL stocks of each sample. Samples can be used for ddPCR immediately or stored at -20°C until ready to use.
Preparing for ddPCR
- Thaw samples, primers/probe mixes, and master mix on ice.
- Before handling any viruses get materials ready.
- Vortex primers/probe mixes and master mix for 15s then spin 10s in a mini centrifuge and place on ice.
- Wipe down a DG8 cartridge holder with bleach and place in the Biological Safety Cabinet (BSC).
- Make sure that the BSC is supplied with sufficient pipette tips.
- Pre-warm the 96-well plate sealer by gently touching the screen.
Preparation of the Master Mix
- Place a ddPCR plate onto a chilled 96-well freezer block and set aside in the BSC to cool.
- Prepare the RRE/RPP30 master mix in a microcentrifuge tube as shown below. For 8 samples prepare enough master mix for 9 samples.
- Vortex the master mix for 15s and spin in a mini centrifuge for 10s before use.
- Place an 8-well PCR tube strip into a chilled 96-well freezer block.
- Add 16 µL of the master mix to each PCR tube. Be careful to dispense to the bottom of the tube without collecting drops along the side of the tube.
- Add 4 µL of the 25 ng/µL samples the appropriate PCR tubes. Pipette back and forth 5 times.
Component | Volume | 9X Volume | Final Concentrations |
---|---|---|---|
2X ddPCR Supermix for Probes, no dUTP | 10 µL | 90 µL | 1X |
20X RRE target primers/probe (FAM) | 1 µL | 9 µL | 900 nM, 250 nM |
20X RPP30 primers/probe (HEX/VIC) | 1 µL | 9 µL | 900 nM, 250 nM |
Nuclease-free water | 4 µL | 36 µL | |
Total Volume | 16 µL | 144 µL |
Generating the Droplets
- Place a DG8 cartridge into the cartridge holder.
- Using a 2-50 µL multichannel pipet, load 20 µL of the reaction mixtures into the middle wells of the cartridge.
- Add 800 µL of droplet generation oil to a polystyrene reagent reservoir.
- Using the 20-200 µL multichannel pipet, load 70 µL of droplet generation oil into the bottom row of wells.
- Cover the cartridge with the DG8 gasket, making sure that it is secure.
- Transfer the cartridge holder to the droplet generator. Close the lid and wait for the droplets to be generated.
- Once the droplets have been generated, use a 20-200 µL multichannel pipette to aspirate 40 µL of droplets.
- Transfer the droplets to a prechilled PCR plate.
- Place a Pierceable Foil Heat Seal on the PCR plate with the red line facing up. If the plate sealer is not at temperature, touch the screen on the plate sealer to allow it to get to temperature. Once the temperature is reached, place the PCR plate with the foil onto the metal support block. Place the block in the plate sealer and press the ‘Seal’ button.
- After the plate has been sealed, proceed to thermocycling.
*Pro-Tip* To ensure that the droplets are not disrupted insert the pipette tips directly in the center of the well and tilt to a 45° angle. Count to 20 while slowly and gently aspirating the droplets.
*Pro-Tip* To ensure that the droplets are not disrupted insert the pipette tips and gently touch the bottom of the well. Lift the tips ~1mm. Touch the side of the well and tilt the pipette tips at a 45° angle. Count to 20 while slowly and gently dispensing the droplets down the side of the tube.
Thermal Cycling
- Run the following PCR parameters:
- After PCR is complete, transfer the plate to the Droplet Reader.
- Open the QuantaSoft software to set up a new plate layout. Designate the sample name, experiment type, supermix type (ddPCR Supermix for Probes), the target names and target types.
- When the plate layout is complete , select 'Run' to begin the droplet reading.
- When the droplet reading is complete, export the data from all wells as a CSV file which will be used to calculate the titer.
Cycling Step | Temperature (°C) | Time (min) | Ramp Rate (°C/sec) | # Cycles |
---|---|---|---|---|
Enzyme Activation | 95 | 10 | 2 | 1 |
Denaturation | 94 | 0.5 | 2 | 40 |
Annealing/Extension | 60 | 1 | 2 | 40 |
Enzyme Deactivation | 98 | 10 | 2 | 1 |
Hold | 4 | ∞ | 2 | 1 |
Calculations
- To calculate the titers, first calculate the number of viruses per cellular genome: $$V = 2*{copies\ RRE \over copies\ RPP30}$$
- Use the viruses/genome to calculate the infectious titer: $$T = {V*C*D\over v}$$
- T = Infectious titer, TU/mL
- V = Viruses per genome
- C = # Cells per well
- D = Dilution factor
- v = Virus volume, mL
- Take the average infectious titer obtained from the appropriate dilutions to calculate the final infectious titer.
Where:
Tips and Troubleshooting
- We recommend wiping down all pipettes and equipment with 10% bleach prior to use and keeping all reagents and samples on ice or pre-chilled 96-well freezer blocks during use.
- To reduce the risk of contaminating reagents we recommend making small aliquots of master mixes, and primers/probe mixes prior to use.
Sample Data
- When analyzing data there should be a clear distinction between negative droplets (black) and positive droplets (blue/green).
- The concentration of RRE positive droplets in the untransduced control should be close to zero (A01).
- In this protocol, the lentiviral particles are serially diluted and used to transduce HEK293T cells. Genomic DNA is extracted from the target cells and assayed for integrated copies of RRE. Since the samples that are assayed are diluted 2-fold serially, the concentration of RRE positive droplets should decrease by a factor of 2 across the dilutions. RPP30 copies should be relatively constant across samples.
- In the RRE example below, 2-fold serial dilutions of a sample were loaded in wells B01-H01. As shown in the image (Figure 1) and table below, the concentration of RRE positive droplets increases by a factor of ~2 as you progress from the higher dilutions to the lower dilutions (blue).
- As shown in the image (Figure 2) below, the concentration of RPP30 positive droplets stays relatively even across samples (green).
- To increase the accuracy of the titer, calculate an average of several dilutions.
Sample ID | Plasmid ID | Dilution | Copies/20 µL RRE (FAM) | Copies/20 µL RPP30 (HEX) | Viruses/genome | Infectious titer (TU/mL) | Average |
---|---|---|---|---|---|---|---|
1 | 800 | 428 | 22020 | 0.03887375114 | 6.22E+06 | ||
2 | 400 | 768 | 18360 | 0.08366013072 | 6.69E+06 | ||
3 | 200 | 1620 | 15840 | 0.2045454545 | 8.18E+06 | ||
4 | 100 | 3180 | 20540 | 0.3096397274 | 6.19E+06 | ||
5 | 50 | 8960 | 17080 | 1.049180328 | 1.05E+07 | ||
6 | 25 | 14440 | 24260 | 1.190436933 | 5.95E+06 | 7.29E+06 | |
7 | Untransduced | 1 | 6.4 | 17940 | 0.0007134894091 | 1.43E+02 |
Reference
Wang Y, Bergelson S, Feschenko M. Determination of Lentiviral Infectious Titer by a Novel Droplet Digital PCR Method. Hum Gene Ther Methods. 2018 Apr;29(2):96-103. doi: 10.1089/hgtb.2017.198. PMID: 29378428 (Link opens in a new window).