-
Purpose(Empty Backbone) A backbone for adenovirus creation by the AdEasy method, similar to ShuttleCMV (Addgene Plasmid # 16403), except it uses a Neuron-specific enolase (NSE) promoter instead of the CMV promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50958 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Login to view industry pricing.
Backbone
-
Vector backbonepShuttle
-
Backbone manufacturerBert Vogelstein lab (Addgene Plasmid #16402)
- Backbone size (bp) 7981
-
Modifications to backboneA 1.1 kb portion of the rat NSE gene was PCR amplified using a forward primer containing AseI and AflII and a reverse primer containing BglII and PvuI sites. Primer sequences are as follows: GGGATTAATCTTAAGGGGACAGTAAAGGTGATGGC, 3’GGGAGATCTCGATCGGAGGACTGCAGACTCAGCC. The PCR product was digested with AseI and BglII and cloned into the AseI and BamHI cut pmRFP-N1 in place of the CMV promoter. The mRFP was removed from this plasmid with PvuI and XbaI and replaced with the PmeI-excised multi-cloning site of pcDNA3.1. The resulting NSE promoter/multicloning site/polyadenylation signal sequence cassette was excised by AflI partial digestion, the DNA fragment agarose gel purified, and then ligated (blunt end) into pShuttle cut with KpnI and SalI.
-
Vector typeMammalian Expression, Adenoviral
- Promoter NSE
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer Encap-F (5'-TTTGGGCGTAACCGAGTAAG-3')
- 3′ sequencing primer pShuttle-R (5'-CACAATGCTTCCATCAAACG-3') (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ShuttleNSE was a gift from James Bamburg (Addgene plasmid # 50958 ; http://n2t.net/addgene:50958 ; RRID:Addgene_50958) -
For your References section:
A genetically encoded reporter for real-time imaging of cofilin-actin rods in living neurons. Mi J, Shaw AE, Pak CW, Walsh KP, Minamide LS, Bernstein BW, Kuhn TB, Bamburg JR. PLoS One. 2013 Dec 31;8(12):e83609. doi: 10.1371/journal.pone.0083609. PubMed 24391794