-
PurposeThis plasmid can be used in the triple transfection method of AAV vector production. It supplies the replication proteins from AAV2 and the engineered shh10 capsid protein.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64867 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneXX2
-
Backbone manufacturerUniversity of North Carolina Dr. Samulski
- Backbone size w/o insert (bp) 5648
- Total vector size (bp) 8182
-
Modifications to backbonereplaced AAV2 cap with shh10 cap
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshh10 cap
-
SpeciesAdeno-associated virus - 6
-
Insert Size (bp)2211
-
MutationI319V, N451D, D532N
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCGGAAGCTTCGATCAACTACGC
- 3′ sequencing primer GCAGTGCCAGGGTTGATTATAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
shh10 was a gift from John Flannery & David Schaffer (Addgene plasmid # 64867 ; http://n2t.net/addgene:64867 ; RRID:Addgene_64867) -
For your References section:
A novel adeno-associated viral variant for efficient and selective intravitreal transduction of rat Muller cells. Klimczak RR, Koerber JT, Dalkara D, Flannery JG, Schaffer DV. PLoS One. 2009 Oct 14;4(10):e7467. doi: 10.1371/journal.pone.0007467. 10.1371/journal.pone.0007467 PubMed 19826483